ID: 1162484776_1162484779

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1162484776 1162484779
Species Human (GRCh38) Human (GRCh38)
Location 19:10952886-10952908 19:10952913-10952935
Sequence CCAGACTCACTCTTCTCAGACTG CACATCTGCAGGTGATGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 317} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!