ID: 1162506569_1162506578

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1162506569 1162506578
Species Human (GRCh38) Human (GRCh38)
Location 19:11089580-11089602 19:11089599-11089621
Sequence CCGTCGCCTTGCTCCTCGCCGCG CGCGGCGGGGACTGCAGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109} {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
257 20:36863791-36863813 CGCGGCGGGAGCGGCAGGGAGGG + 20:36864071-36864093 CCAGCGCCTCGCCCCTCGCCCCG -
-4 19:11089580-11089602 CCGTCGCCTTGCTCCTCGCCGCG - 19:11089599-11089621 CGCGGCGGGGACTGCAGGTAAGG +