ID: 1162524123_1162524144

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1162524123 1162524144
Species Human (GRCh38) Human (GRCh38)
Location 19:11197611-11197633 19:11197643-11197665
Sequence CCCCCCCAGCCGGCACCGCCCCC CCGGGCGCCCCGGCCGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 16, 3: 166, 4: 1424} {0: 1, 1: 0, 2: 1, 3: 20, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!