ID: 1162527383_1162527387

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1162527383 1162527387
Species Human (GRCh38) Human (GRCh38)
Location 19:11214339-11214361 19:11214368-11214390
Sequence CCCAGGCTGTACAGCACAACCTT TGCCCCCAAGACGCTCTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 160} {0: 1, 1: 0, 2: 2, 3: 19, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!