ID: 1162561689_1162561698

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1162561689 1162561698
Species Human (GRCh38) Human (GRCh38)
Location 19:11421189-11421211 19:11421221-11421243
Sequence CCTTCCCTCTAAGCTGGCGAGGA GGATGGGAAGCGAGAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} {0: 1, 1: 1, 2: 13, 3: 192, 4: 1760}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!