ID: 1162561689_1162561702

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1162561689 1162561702
Species Human (GRCh38) Human (GRCh38)
Location 19:11421189-11421211 19:11421229-11421251
Sequence CCTTCCCTCTAAGCTGGCGAGGA AGCGAGAGAGGAAGGTGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} {0: 1, 1: 0, 2: 23, 3: 125, 4: 1693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!