ID: 1162562741_1162562749

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1162562741 1162562749
Species Human (GRCh38) Human (GRCh38)
Location 19:11426868-11426890 19:11426905-11426927
Sequence CCTACCTTGGCCACCTCCGTGTG CCGCCATCTCCAGAAGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216} {0: 1, 1: 0, 2: 2, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!