ID: 1162567946_1162567953

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1162567946 1162567953
Species Human (GRCh38) Human (GRCh38)
Location 19:11454357-11454379 19:11454371-11454393
Sequence CCCACCCCAGAGTGCTCACCCTG CTCACCCTGTGGCTTCCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 274} {0: 1, 1: 0, 2: 0, 3: 12, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!