ID: 1162584781_1162584790

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1162584781 1162584790
Species Human (GRCh38) Human (GRCh38)
Location 19:11552087-11552109 19:11552125-11552147
Sequence CCAGGGCTTCCGGGCCAGCTCAA TTCACATCCGTCAGTGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 161} {0: 1, 1: 0, 2: 1, 3: 8, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!