ID: 1162665730_1162665734

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1162665730 1162665734
Species Human (GRCh38) Human (GRCh38)
Location 19:12210214-12210236 19:12210238-12210260
Sequence CCTCCCAGGTTCAAGCGATTCTC TTGCCTCAGCCTGAGATTACAGG
Strand - +
Off-target summary {0: 23056, 1: 86015, 2: 148378, 3: 189355, 4: 137836} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!