ID: 1162686753_1162686756

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1162686753 1162686756
Species Human (GRCh38) Human (GRCh38)
Location 19:12393095-12393117 19:12393116-12393138
Sequence CCCATCAATAGTAGGCTAAGATG TGTGGACAAAAAGTTATATGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 73} {0: 2, 1: 0, 2: 1, 3: 18, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!