ID: 1162715945_1162715950

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1162715945 1162715950
Species Human (GRCh38) Human (GRCh38)
Location 19:12633647-12633669 19:12633684-12633706
Sequence CCTTCATGTGTGGCCCAAGCATC ATGGTTGGCATTGTTCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 148} {0: 1, 1: 0, 2: 0, 3: 29, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!