ID: 1162733085_1162733096

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1162733085 1162733096
Species Human (GRCh38) Human (GRCh38)
Location 19:12730641-12730663 19:12730677-12730699
Sequence CCGGCACTAAGTCAAGTTCTTTA ATGGCTAAGGGGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138} {0: 1, 1: 0, 2: 9, 3: 89, 4: 1082}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!