ID: 1162739862_1162739868

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1162739862 1162739868
Species Human (GRCh38) Human (GRCh38)
Location 19:12767755-12767777 19:12767776-12767798
Sequence CCTGTTCTACCCAAACAGTACAC ACCAGGACAGGTAAGACCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 106} {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!