ID: 1162796584_1162796597

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1162796584 1162796597
Species Human (GRCh38) Human (GRCh38)
Location 19:13090425-13090447 19:13090473-13090495
Sequence CCAGGGGAGTAGTCAGGGTTGGG CTGGAGTCCTTGGGGCTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 237} {0: 1, 1: 0, 2: 1, 3: 15, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!