ID: 1162913434_1162913441

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1162913434 1162913441
Species Human (GRCh38) Human (GRCh38)
Location 19:13862074-13862096 19:13862112-13862134
Sequence CCACTGGGCCAGGATCCAGGAAT GACCCAGTTCAGGAATGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 218} {0: 1, 1: 0, 2: 1, 3: 15, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!