ID: 1163021372_1163021379

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1163021372 1163021379
Species Human (GRCh38) Human (GRCh38)
Location 19:14482640-14482662 19:14482662-14482684
Sequence CCTCTGGTCCACCATCAGGGACC CCTGGTGCCCGGCTCCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 154} {0: 1, 1: 0, 2: 4, 3: 27, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!