ID: 1163369082_1163369089

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1163369082 1163369089
Species Human (GRCh38) Human (GRCh38)
Location 19:16892133-16892155 19:16892150-16892172
Sequence CCCACGACGCACTGGTGTCTGAG TCTGAGATGGGGCTGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49} {0: 1, 1: 1, 2: 5, 3: 67, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!