ID: 1163432323_1163432333

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1163432323 1163432333
Species Human (GRCh38) Human (GRCh38)
Location 19:17275777-17275799 19:17275819-17275841
Sequence CCTTCTCCTTAGCACCCCCACCA GCCTCATGTAAGTCCCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 448} {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!