ID: 1163449184_1163449193

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1163449184 1163449193
Species Human (GRCh38) Human (GRCh38)
Location 19:17365606-17365628 19:17365639-17365661
Sequence CCAGCTCCTCCACCTTGGAGCTC GCATGTGGTCGCAGGCTCTGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 63, 4: 532} {0: 1, 1: 0, 2: 0, 3: 13, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!