ID: 1163503227_1163503235

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163503227 1163503235
Species Human (GRCh38) Human (GRCh38)
Location 19:17688221-17688243 19:17688247-17688269
Sequence CCGGAGGCGGCCGGGCCGGCTCT GGGTCGGGCTCAGCGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162} {0: 1, 1: 0, 2: 1, 3: 11, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!