ID: 1163556090_1163556109

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1163556090 1163556109
Species Human (GRCh38) Human (GRCh38)
Location 19:17993546-17993568 19:17993595-17993617
Sequence CCGACCTAGCCAAGGTGAGTGGG AGGTGGGGCCCCGGAGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114} {0: 1, 1: 0, 2: 3, 3: 29, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!