ID: 1163565540_1163565551

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1163565540 1163565551
Species Human (GRCh38) Human (GRCh38)
Location 19:18049007-18049029 19:18049059-18049081
Sequence CCACTTCTGGGGCCTTCATGTCT CATGGCCGTACCTGTACCGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!