ID: 1163587718_1163587729

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1163587718 1163587729
Species Human (GRCh38) Human (GRCh38)
Location 19:18173149-18173171 19:18173198-18173220
Sequence CCACTCCCTGCGCCAGCTTCTGC GAGTCAGTCCCACGGGACCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 606} {0: 1, 1: 0, 2: 0, 3: 2, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!