ID: 1163612030_1163612037

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1163612030 1163612037
Species Human (GRCh38) Human (GRCh38)
Location 19:18306637-18306659 19:18306650-18306672
Sequence CCCCTTGGCATTAACGTCTCCAC ACGTCTCCACAGAGGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!