ID: 1163631413_1163631428

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1163631413 1163631428
Species Human (GRCh38) Human (GRCh38)
Location 19:18419683-18419705 19:18419714-18419736
Sequence CCTCCGACAGCCAGGCCCGCGAG GCGGGGCCGGGGGCGGGGCTCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 10, 4: 126} {0: 3, 1: 13, 2: 142, 3: 857, 4: 3093}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!