ID: 1163635571_1163635584

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1163635571 1163635584
Species Human (GRCh38) Human (GRCh38)
Location 19:18435729-18435751 19:18435773-18435795
Sequence CCCGCGCCCGCGCCCGCGCCCCA TCGCCGGGCGTATAGAGCACTGG
Strand - +
Off-target summary {0: 3, 1: 8, 2: 48, 3: 173, 4: 1122} {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!