ID: 1163699334_1163699344

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1163699334 1163699344
Species Human (GRCh38) Human (GRCh38)
Location 19:18779413-18779435 19:18779433-18779455
Sequence CCCTTTCTCTTACCATGACAGAG GAGGCTGGGGGCAGACAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 264} {0: 1, 1: 0, 2: 6, 3: 69, 4: 592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!