ID: 1163755935_1163755945

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1163755935 1163755945
Species Human (GRCh38) Human (GRCh38)
Location 19:19106165-19106187 19:19106182-19106204
Sequence CCCTGTCCCCGCCCCAGCAGAGA CAGAGACGTGCGGGTGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 361} {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!