ID: 1163760323_1163760324

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1163760323 1163760324
Species Human (GRCh38) Human (GRCh38)
Location 19:19132931-19132953 19:19132949-19132971
Sequence CCAGGAAACAGATGCTAACTTGA CTTGACAGTGACCATCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 227} {0: 1, 1: 0, 2: 3, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!