ID: 1163762348_1163762349

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1163762348 1163762349
Species Human (GRCh38) Human (GRCh38)
Location 19:19144643-19144665 19:19144656-19144678
Sequence CCTCAACTATTTTCTGGGAGCAC CTGGGAGCACCCCTGACCTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!