ID: 1163768676_1163768683

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1163768676 1163768683
Species Human (GRCh38) Human (GRCh38)
Location 19:19177842-19177864 19:19177873-19177895
Sequence CCAAGCCGGGCTCTGCTCTTCTC CCCTTTTTTTTTTTGGTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 273} {0: 1, 1: 2, 2: 27, 3: 359, 4: 2680}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!