ID: 1163781413_1163781419

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1163781413 1163781419
Species Human (GRCh38) Human (GRCh38)
Location 19:19251048-19251070 19:19251070-19251092
Sequence CCAAATGTGCAACCTGTAAAAGG GTCTCTCCACACCAGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 125} {0: 1, 1: 0, 2: 1, 3: 16, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!