ID: 1163823013_1163823017

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1163823013 1163823017
Species Human (GRCh38) Human (GRCh38)
Location 19:19507083-19507105 19:19507108-19507130
Sequence CCCCAAATTTCTCACTAATTTTT TTTTTTGTGCATAACTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 92, 4: 756} {0: 1, 1: 0, 2: 0, 3: 21, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!