ID: 1163833860_1163833868

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1163833860 1163833868
Species Human (GRCh38) Human (GRCh38)
Location 19:19561844-19561866 19:19561879-19561901
Sequence CCATCTCGAGTCGCAGCAGACAC CACGGGCCTGGCTGAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 63} {0: 1, 1: 1, 2: 5, 3: 43, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!