ID: 1164617145_1164617155

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1164617145 1164617155
Species Human (GRCh38) Human (GRCh38)
Location 19:29674061-29674083 19:29674091-29674113
Sequence CCGCAGCCAGCACATCATCCCCC GGTCACACTGGAGCTGTTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 340} {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!