ID: 1164624006_1164624015

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1164624006 1164624015
Species Human (GRCh38) Human (GRCh38)
Location 19:29714926-29714948 19:29714969-29714991
Sequence CCATGCCTCAGTTTCTCCATAGG TGTCCACCCCGGCACCGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 224, 4: 1077} {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!