ID: 1164658520_1164658532

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1164658520 1164658532
Species Human (GRCh38) Human (GRCh38)
Location 19:29942255-29942277 19:29942292-29942314
Sequence CCGCCACGCGACGCCTGGCTGGG GCGTCTCGGTACCTGGCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137} {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!