ID: 1164743578_1164743582

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1164743578 1164743582
Species Human (GRCh38) Human (GRCh38)
Location 19:30594731-30594753 19:30594749-30594771
Sequence CCACTCTTCTCCTGTTTCCCCTG CCCTGCGAGAAGCCGCTGCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!