ID: 1164977021_1164977033

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1164977021 1164977033
Species Human (GRCh38) Human (GRCh38)
Location 19:32581122-32581144 19:32581172-32581194
Sequence CCTGGCAGCGGCGCGGGGCGTGG CCCCGCGAGCGCCTGCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 363} {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!