ID: 1165156693_1165156702

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1165156693 1165156702
Species Human (GRCh38) Human (GRCh38)
Location 19:33793070-33793092 19:33793103-33793125
Sequence CCATGTTTCGTCACTCCCTTTAG CTCTGGGGTCCTAACTAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 130} {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!