ID: 1165157571_1165157579

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1165157571 1165157579
Species Human (GRCh38) Human (GRCh38)
Location 19:33797314-33797336 19:33797338-33797360
Sequence CCCCGCACTCTGGCCCCTGTTCT GGCCGAGCGCCCTGCAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!