ID: 1165161241_1165161242

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1165161241 1165161242
Species Human (GRCh38) Human (GRCh38)
Location 19:33817811-33817833 19:33817825-33817847
Sequence CCTGGGTGACAGAGTGAGACTCC TGAGACTCCTTCTCAAAAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 85, 3: 266, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!