ID: 1165243077_1165243092

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1165243077 1165243092
Species Human (GRCh38) Human (GRCh38)
Location 19:34482363-34482385 19:34482409-34482431
Sequence CCGGTCCCGGGCCGCCTTCGGTG CAGCCTCGGCTCCCGGGGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82} {0: 1, 1: 0, 2: 2, 3: 33, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!