ID: 1165393515_1165393524

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1165393515 1165393524
Species Human (GRCh38) Human (GRCh38)
Location 19:35551437-35551459 19:35551490-35551512
Sequence CCAGGGACACCTGAAGAAGCCTT GGATGAGGACATCGGCGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190} {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!