ID: 1165409651_1165409657

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1165409651 1165409657
Species Human (GRCh38) Human (GRCh38)
Location 19:35651424-35651446 19:35651444-35651466
Sequence CCAGCCTCCTCCCTTTTATTCTG CTGAACATCCTTACTCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 643} {0: 1, 1: 0, 2: 2, 3: 9, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!