ID: 1165420047_1165420070

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1165420047 1165420070
Species Human (GRCh38) Human (GRCh38)
Location 19:35718049-35718071 19:35718090-35718112
Sequence CCCGGGCCTGGCTCCGCGCGGGG GCGGGGCGCCGGCGGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 382} {0: 1, 1: 4, 2: 65, 3: 373, 4: 2006}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!