ID: 1165428533_1165428541

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1165428533 1165428541
Species Human (GRCh38) Human (GRCh38)
Location 19:35758566-35758588 19:35758608-35758630
Sequence CCCAGTGGATCCTGGGGCTTGTA TCGTGTCCCCCAGGAATGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159} {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!