ID: 1165618754_1165618758

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1165618754 1165618758
Species Human (GRCh38) Human (GRCh38)
Location 19:37226341-37226363 19:37226367-37226389
Sequence CCCACATGGACACTCAGAGTCTA TTTACATTAGGGTTCACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124} {0: 11, 1: 204, 2: 564, 3: 742, 4: 815}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!