ID: 1165712656_1165712668

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1165712656 1165712668
Species Human (GRCh38) Human (GRCh38)
Location 19:38023226-38023248 19:38023248-38023270
Sequence CCTATCTTCTGGAGAGGGTGAGG GCGGTGGGGCCGGGGGTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 1367, 4: 26985} {0: 1, 1: 0, 2: 2, 3: 65, 4: 736}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!